Rapid DNA extraction and PCR validation for direct detection of Listeria monocytogenes in raw milk

Rapid DNA extraction and PCR validation for direct detection of Listeria monocytogenes in raw milk

Published 2006-01-01

Open | Download
PDF (Spanish) FLIP
How to Cite
Burbano, E., Sierra, S., Torres, K., Mercado, M., Carrascal, A., & Poutou, R. (2006). Rapid DNA extraction and PCR validation for direct detection of Listeria monocytogenes in raw milk. Journal MVZ Cordoba, 11(1). https://doi.org/10.21897/rmvz.456
doi

https://doi.org/10.21897/rmvz.456
Dimensions
PlumX
Edith Burbano
Sara Sierra
Kirvis Torres
Marcela Mercado
Ana Carrascal
Raúl Poutou
Show authors biography

Edith Burbano

Laboratorio de Microbiología de Alimentos

Sara Sierra

Laboratorio de Microbiología de Alimentos

Kirvis Torres

Laboratorio de Microbiología de Alimentos

Marcela Mercado

Laboratorio de Microbiología de Alimentos

Ana Carrascal

Laboratorio de Microbiología de Alimentos

Raúl Poutou

Laboratorio de Biotecnología Aplicada. Grupo de Biotecnología Ambiental e Industrial
Objetivo. Validar un método para la detección directa de L. monocytogenes en leche cruda. Materiales y métodos. Se utilizó un procedimiento de extracción con el agente caotropico NaI, para reducir la grasa en la muestra a un 0.2% p/v, el cual es mas bajo limite de detección con el método de Gerber para evitar la polimerización. Las muestras de leche cruda fueron analizadas por el método estandar de oro para la detección de L. monocytogenes. La detección por PCR fue realizada amplificando el segmento específico de 938bp de 16S ADNr. Los siguientes cebadores fueron utilizados L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) que reconoce el gen hlyA de L. monocytogenes y que amplifica un fragmento de 750bp.Resultados. El ADN de 39 cepas evidenció una alta especificidad de la técnica ya que todas las 39 L. monocytogenes amplificaron los fragmentos de 938bp y 750bp especie especifica. El límite de detección de la PCR fue de 101 CFU/ml. La reproducibilidad de la PCR mostró un Kappa de 0.85, la especificidad y sensibilidad fueron del 100%. El valor predictivo positivo y negativo fue del 100%. Conclusiones. Los resultados demostraron que es posible detectar Listeria spp usando cualquiera de los tres métodos ya que poseen la misma sensibilidad y especificidad. El 100% del valor predictivo positivo provee una alta posibilidad de detección en muestras positivas con listeria. EL método de extracción y la PCR estandarizada permiten en 15 días detectar L. monocytogenes en leches crudas. La técnica de PCR puede ser adaptada y validada otros tipos de alimentos como pollos, carnes y quesos.

Article visits 711 | PDF visits

Downloads

Download data is not yet available.
  1. Gray M, Killinger A. Listeria monocytogenes and Listeric Infections. Bacteriology Review 1996; 30:309-382.
  3. Basser H, Flood S, Livak J, Kenneth J, Marmaro J, Knorr R, Batt C. Use of a Fluorogenic Probe in a PCR Based for the Detection of Listeria monocytogenes. Applied and Environmental Microbiology 1995; 61:3724-3728.
  5. Alpas H, Kalchayanand N, Bozoglu F, Sikes A, Dunne C, Ray B. Variation in Resistance to Hydrostatic Pressure Among Strains of Food-borne Pathogens. Applied and Environmental Microbiology 1999; 65:4248-4251.
  7. Pinner R, Schuchat A, Swaminathan B, Hayes P, Deaver K, Weaver R, Plikaytis B, Reeves M, Broome C, Wenger J. Role of Foods in Sporadic Listeriosis II. Microbiologic and Epidemiologic Investigation. Journal of the American Medical Association 1992; 267:2046-2050. http://dx.doi.org/10.1001/jama.1992.03480150052036
  8. http://dx.doi.org/10.1001/jama.267.15.2046
  10. Ryser E, Arimi S, Marie-Claire M, Donelly C. Recovery of Different Listeria Ribotypes From Naturally Contaminated, Raw Refrigerated Meat and Poultry Products with Two Primary Enrichment Media. Applied and Environmental Microbiology 1996; 62:1781- 1787.
  12. Díaz G, Mu-oz A. Incidencia de Listeria monocytogenes en Leches Crudas y Pasteurizadas en el Antiplano Cundiboyacense. Biomédica 1994; 14:58.
  14. Vanegas M, Vergara J, Rojas I. Prevalencia de Listeria monocytogenes en Quesos Distribuidos en Bogotá D.C. 2003. Memorias 1er Congreso Colombiano de Microbiología de Alimentos. Bogotá, D.C., Universidad de Los Andes, Facultad de Ciencias.104-105.
  16. Blais B, Phillippe L. Simple RNA Probe System for Analysis of L. monocytogenes Polymerase Chain Reaction Products. Applied and Environmental Microbiology 1993; 59:2795- 2800.
  18. Crandall D, Montville J. Nisin Resistance in Listeria monocytogenes ATCC 700302 is a Complex Phenotype. Applied and Environmental Microbiology 1998; 64:231-237.
  20. Lachica R. Hemolytic Activity Reevaluatation of Putative Nonpathogenic Listeria monocytogenes Strains. Applied and Environmental Microbiology 1996; 62:4293-4295.
  22. Farber J, Peterkin P. Listeria monocytogenes, a Foodborne Pathogen. Microbiological Reviews 1991; 55:476-511.
  24. Amador E, Almazán M, Quintana M, Poutou R, Candelario M. Estudio Preliminar de la Estabilidad de los Bancos de Células Primarios para la Producción de Interferón alfa Recombinante. Biotecnología Aplicada 1994; 11:60-63.
  26. Poutou R, Amador E, Candelario M. Banco de Células Primario (BCP): Caracterización y Papel en la Producción de Proteínas Recombinantes. Biotecnología Aplicada 1994; 11:55-59.
  28. Sambrook J, Manniatis T, Fritsch E. Molecular Cloning: A Laboratory Manual. 1989. New York, Cold Spring Harbor Laboratory Press.
  30. Burbano E. Validación De PCR Para La Deteccion De Listeria monocytogenes En Leches. 2002. Tesis de Maestría. Departamento de Microbiología, Pontificia Universidad Javeriana. Bogotá, D.C. p.117
  32. Khan M, Kakoma I, Morin E, Hansen R, Hurley W, Tripathy N, Baek K. Detection of Staphylococcus aureus in Milk by Use of Polymerase Chain Reaction Analysis. American Journal of Veterinary Research 1998; 59:807-813.
  34. Bansal N. Development of a Polymerase Chain Reaction Assay for the Detection of Listeria monocytogenes in Foods. Applied Microbiology 1996; 22:353-356. http://dx.doi.org/10.1111/j.1472-765X.1996.tb01177.x
  36. Zamora A, Ossa H, Carrascal A, Poutou R, Jiménez D. Identificación Preliminar de L. monocytogenes por PCR. Laboratorio Actual 2000; 17:38-41.
  38. Allaert C, Escolá M. Métodos de Análisis Microbiológicos de Alimentos. 2002. Díaz de Santos S.A.
  40. ICMSF. Microorganismos de los Alimentos I. Técnicas de Análisis Microbiológico. 2001. Zaragoza, Acibia. S.A.
  42. Makino S, Okada Y, Maruyama T. A New Method for Direct Detection of Listeria monocytogenes From Food by PCR. Applied and Environmental Microbiology 1995; 61:3745-3747.
  44. Sox H. Common Diagnostic Tests Use and Interpretation. 1987. Philadelphia, American College of Physicians.
  46. Pauker S, Kassirer J. Therapeutic Decision Making: A Cost - Benefit Analysis. A Thehreshold Approach to Therapeutic Decision Making. New England Journal of Medicine 1995; 293:229-234. http://dx.doi.org/10.1056/NEJM197507312930505
  48. Peeler J, Bunning K. Hazzard Assessment of Listeria monocytogenes in the Processing of Bovine Milk. Journal of Food Protection 1994; 57:689-697.
  50. Mengaud J, Vicente M, Chenevert J. Expression in Escherichia coli and Sequence Analysis of the Listeriolisina O Determinants of Listeria monocytogenes. Infection and Immunity 1998; 51:314-319.
  52. Border P, Howard J, Plastow G, Siggens K. Detection of Listeria Species and Listeria monocytogenes Using Polymerase Chain Reaction. Letter Applied Microbiology 1990; 11:158-162. http://dx.doi.org/10.1111/j.1472-765X.1990.tb00149.x
  54. Allmann M, Hofelein C, Koppel E, Luthy J, Meyer R, Niederhauser C, Wegmuller B, Candrian U. Polymerase Chain Reaction (PCR) for Detection of Pathogenic Microorganisms in Bacteriological Monitoring of Dairy Products. Research Microbiology 1995; 146:85-97. http://dx.doi.org/10.1016/0923-2508(96)80273-7
  56. Moyra C, Simon D, Gray N. DNA Extraction and PCR Methods for the Detection of Listeria monocytogenes in Cold Smoked Salmon. Applied and Environmental Microbiology 1996; 62:822-824.
  58. Unnerstad H, Ericsson H, Alderborn A, Tham W, Danielsson-Tham M, Mattson J. Pyrosequencing as a Method for Grouping of Listeria monocytogenes Strains on the Basis of Single-Nucleotide Polymorphisms in the in lB Gene. Applied and Environmental Microbiology 2001; 67:5339-5342. http://dx.doi.org/10.1128/AEM.67.11.5339-5342.2001
  60. Hough A, Harbison S, Savill M, Melton L, Fletcher G. Rapid Enumeration of Listeria monocytogenes in Artificially Contaminated Cabbage Using Real Time Polymerase Chain. Journal of Food Protection 2002; 65:1329-1332.
  62. De Buyser M, Dufour B, Maire M, Lafarge V. Implication of Milk and Milk Products in Foodborne Diseases in France and in Different Industrialised Countries. International Journal of Food Microbiology 2001; 67:1-17. http://dx.doi.org/10.1016/S0168-1605(01)00443-3
  64. Leclerc V, Bufour B, Lombard B, Gauchard F, Garin-Bastuji B, Salvat G, Brisabois A, Poumeyrol M, De Buyser M, Gnanou-Besse N, Lahellec C. Pathogens in Meat and Milk Products: Surveillance and Impact on Human Health in France. Livestock Production Science 2002; 76:195-202. http://dx.doi.org/10.1016/S0301-6226(02)00126-4
  66. Hofer E, Nascimiento R, Oliveira M. Meningite por Listeria monocytogenes. Relato de casos em pacientes do Distrito Federal. Revista da Sociedade Brasileira de Medicina Tropical 1998; 31:173-177. http://dx.doi.org/10.1590/S0037-86821998000200002
  68. Crespo M, Vélez J, Casta-eda C, Hoyos F, López M, Salazar J. Aislamiento de Listeria monocytogenes en un Hospital de Tercer Nivel. Colombia Médica 1999; 30:89-98.
  70. Nardone R, Alessandrini F, Tezzon F. Syringomyelia Following Listeria Meningoencephalitis: Report of a Case. Neurology Sciences 2003; 24:40-43. http://dx.doi.org/10.1007/s100720300021
  72. Escarcega H, Pe-aloza R, Montes O, Pe-a R, Godoy H, Negrin M, Rodríguez R, Anaya P. Listeriosis Materno-Fetal: Reporte de Tres Casos. Revista Mexicana de Puericultura y Pediatría 1999; 6:290-296.

Information

SCImago Journal & Country Rank

0.6
2020CiteScore
 
 
28th percentile
Powered by  Scopus
Redib Widget
Tutorials

Autors:

How send article?

Evaluator pair

How to evaluate an article?

Keywords

QR code

Current Issue

Perfil de Google Scholar

Most read in the last 30 days

Sistema OJS 3.4.0.3 - Metabiblioteca |